Featured post

c# - Usage of Server Side Controls in MVC Frame work -

i using asp.net 4.0 , mvc 2.0 web application. project requiremrnt have use server side control in application not possibl in noraml case. ideally want use adrotator control , datalist control. i saw few samples , references in codepleax mvc controllib howwver found less useful. can tell how utilize theese controls in asp.net application along mvc. note: please provide functionalities related adrotator , datalist controls not equivalent functionalities thanks in advace. mvc pages not use normal .net solution makes use of normal .net components impossible. a normal .net page use event driven solution call different methods service side mvc use actions , view completly different way handle things. also, mvc not use viewstate normal .net controlls require. found article discussing mixing of normal .net , mvc.

How to perform basic Multiple Sequence Alignments in R? -


(i've tried asking on biostar, slight chance text mining think there better solution, reposting here)

the task i'm trying achieve align several sequences.

i don't have basic pattern match to. know "true" pattern should of length "30" , sequences have had missing values introduced them @ random points.

here example of such sequences, on left see real location of missing values, , on right see sequence able observe.

my goal reconstruct left column using sequences i've got on right column (based on fact many of letters in each position same)

                     real_sequence           the_sequence_we_see 1   cgcaatactaac-agctgacttacgcaccg cgcaatactaacagctgacttacgcaccg 2   cgcaatactagc-aggtgacttcc-ct-cg   cgcaatactagcaggtgacttccctcg 3   cgcaatgatcac--ggtggctcccggtgcg  cgcaatgatcacggtggctcccggtgcg 4   cgcaatactaacca-ctaact--cgctgcg   cgcaatactaaccactaactcgctgcg 5   cgcacgggtaagaacgtga-ttacgctcag cgcacgggtaagaacgtgattacgctcag 6   cgctatactaacaa-gtg-cttaggc-ctg   cgctatactaacaagtgcttaggcctg 7   ccca-c-ctaa-acggtgacttacgctccg   cccacctaaacggtgacttacgctccg 

here example code reproduce above example:

atcg <- c("a","t","c","g") set.seed(40) original.seq <- sample(atcg, 30, t) seqs <- matrix(original.seq,200,30, t) change.letters <- function(x, number.of.changes = 15, letters.to.change.with = atcg)  {     number.of.changes <- sample(seq_len(number.of.changes), 1)     new.letters <- sample(letters.to.change.with , number.of.changes, t)     where.to.change.the.letters <- sample(seq_along(x) , number.of.changes, f)     x[where.to.change.the.letters] <- new.letters     return(x) } change.letters(original.seq) insert.missing.values <- function(x) change.letters(x, 3, "-")  insert.missing.values(original.seq)  seqs2 <- t(apply(seqs, 1, change.letters)) seqs3 <- t(apply(seqs2, 1, insert.missing.values))  seqs4 <- apply(seqs3,1, function(x) {paste(x, collapse = "")}) require(stringr) # library(help=stringr) all.seqs <- str_replace(seqs4,"-" , "")  # how allign this? data.frame(real_sequence = seqs4, the_sequence_we_see = all.seqs) 

i understand if had string , pattern able use

library(biostrings) pairwisealignment(...) 

but in case present dealing many sequences align 1 (instead of aligning them 1 pattern).

is there known method doing in r?

thanks,

tal

though quite old thread, not want miss opportunity mention that, since bioconductor 3.1, there package 'msa' implements interfaces 3 different multiple sequence alignment algorithms: clustalw, clustalomega, , muscle. package runs on major platforms (linux/unix, mac os, , windows) , self-contained in sense need not install external software. more information can found on http://www.bioinf.jku.at/software/msa/ , http://www.bioconductor.org/packages/release/bioc/html/msa.html.


Comments