Featured post

c# - Usage of Server Side Controls in MVC Frame work -

-
i using asp.net 4.0 , mvc 2.0 web application. project requiremrnt have use server side control in application not possibl in noraml case. ideally want use adrotator control , datalist control. i saw few samples , references in codepleax mvc controllib howwver found less useful. can tell how utilize theese controls in asp.net application along mvc. note: please provide functionalities related adrotator , datalist controls not equivalent functionalities thanks in advace. mvc pages not use normal .net solution makes use of normal .net components impossible. a normal .net page use event driven solution call different methods service side mvc use actions , view completly different way handle things. also, mvc not use viewstate normal .net controlls require. found article discussing mixing of normal .net , mvc.
3 comments

How to perform basic Multiple Sequence Alignments in R? -

-

(i've tried asking on biostar, slight chance text mining think there better solution, reposting here)

the task i'm trying achieve align several sequences.

i don't have basic pattern match to. know "true" pattern should of length "30" , sequences have had missing values introduced them @ random points.

here example of such sequences, on left see real location of missing values, , on right see sequence able observe.

my goal reconstruct left column using sequences i've got on right column (based on fact many of letters in each position same)

                     real_sequence           the_sequence_we_see 1   cgcaatactaac-agctgacttacgcaccg cgcaatactaacagctgacttacgcaccg 2   cgcaatactagc-aggtgacttcc-ct-cg   cgcaatactagcaggtgacttccctcg 3   cgcaatgatcac--ggtggctcccggtgcg  cgcaatgatcacggtggctcccggtgcg 4   cgcaatactaacca-ctaact--cgctgcg   cgcaatactaaccactaactcgctgcg 5   cgcacgggtaagaacgtga-ttacgctcag cgcacgggtaagaacgtgattacgctcag 6   cgctatactaacaa-gtg-cttaggc-ctg   cgctatactaacaagtgcttaggcctg 7   ccca-c-ctaa-acggtgacttacgctccg   cccacctaaacggtgacttacgctccg

here example code reproduce above example:

atcg <- c("a","t","c","g") set.seed(40) original.seq <- sample(atcg, 30, t) seqs <- matrix(original.seq,200,30, t) change.letters <- function(x, number.of.changes = 15, letters.to.change.with = atcg)  {     number.of.changes <- sample(seq_len(number.of.changes), 1)     new.letters <- sample(letters.to.change.with , number.of.changes, t)     where.to.change.the.letters <- sample(seq_along(x) , number.of.changes, f)     x[where.to.change.the.letters] <- new.letters     return(x) } change.letters(original.seq) insert.missing.values <- function(x) change.letters(x, 3, "-")  insert.missing.values(original.seq)  seqs2 <- t(apply(seqs, 1, change.letters)) seqs3 <- t(apply(seqs2, 1, insert.missing.values))  seqs4 <- apply(seqs3,1, function(x) {paste(x, collapse = "")}) require(stringr) # library(help=stringr) all.seqs <- str_replace(seqs4,"-" , "")  # how allign this? data.frame(real_sequence = seqs4, the_sequence_we_see = all.seqs)

i understand if had string , pattern able use 

library(biostrings) pairwisealignment(...)

but in case present dealing many sequences align 1 (instead of aligning them 1 pattern).

is there known method doing in r?

thanks,

tal

though quite old thread, not want miss opportunity mention that, since bioconductor 3.1, there package 'msa' implements interfaces 3 different multiple sequence alignment algorithms: clustalw, clustalomega, , muscle. package runs on major platforms (linux/unix, mac os, , windows) , self-contained in sense need not install external software. more information can found on http://www.bioinf.jku.at/software/msa/ , http://www.bioconductor.org/packages/release/bioc/html/msa.html.


Comments

Post a Comment

Popular posts from this blog

c# - Usage of Server Side Controls in MVC Frame work -

-
i using asp.net 4.0 , mvc 2.0 web application. project requiremrnt have use server side control in application not possibl in noraml case. ideally want use adrotator control , datalist control. i saw few samples , references in codepleax mvc controllib howwver found less useful. can tell how utilize theese controls in asp.net application along mvc. note: please provide functionalities related adrotator , datalist controls not equivalent functionalities thanks in advace. mvc pages not use normal .net solution makes use of normal .net components impossible. a normal .net page use event driven solution call different methods service side mvc use actions , view completly different way handle things. also, mvc not use viewstate normal .net controlls require. found article discussing mixing of normal .net , mvc.
Read more

cocoa - Nesting arrays into NSDictionary object (Objective-C) -

-
i define tasks using nsdictionary, i'd save in plist file (i didn't have luck core data far), got stuck @ 2 points: -- when using initwithobjectsandkeys: can change data type number or boolean, using nsdate's numberwithint: , numberwithbool: methods, respectively. can't seem find method change type date though. couldn't find in documentation. -- second problem ran nested arrays. how can add them dictionary? i have uploaded picture here of trying achieve. thank in advance! do mean nsnumber 's +numberwithint: , +numberwithbool: methods, not nsdate ? it's nsnumber defines methods. to convert number date, depends on number is. if it's unix timestamp, [nsdate datewithtimeintervalsince1970:thetimestampinseconds] . as adding nsarray objects dictionary: [yourdictionary setobject:yourarray forkey:@"somekey"]; you'll have post code if need more question isn't clear.
Read more

ios - Very simple iPhone App crashes on UILabel settext -

-
i have simple application. have button , label in ib. have ibaction onclick calls settext on label. there's outlet label. connected in ib. crashes app first time in simulator. when launch again, sets text. crashes again next time. crashes on actual device. should simple, i'm not sure i'm doing wrong. thanks. in .h file : #import <uikit/uikit.h> @interface untitledviewcontroller : uiviewcontroller { iboutlet uilabel *label; iboutlet uibutton *button; } @property (nonatomic, retain) uilabel *label; -(ibaction) onclick1: (id) sender; @end and in .m: - (ibaction) onclick1: (id) sender { //[label settext:@"hello world!"]; label.text = @"hello world!"; //[button settitle:@"clicked" forstate:uicontrolstatenormal]; } sorry, i'm new site. how crash log , stack? thanks. edit : while answer technically correct, doesn't answer question @ :( sorry < warning - guess > if you're
Read more